Знаймо

Додати знання

приховати рекламу

Цей текст може містити помилки.

Гаплогруппа R1b (Y-ДНК)



План:


Введення


R1b - "західноєвропейська" гаплогрупа [2], найбільш поширена в Західній Європі і на Південному Уралі. Зустрічається також у Центральної Азії, Східній Європі, Північній Африці, в Арабських країнах. Після міграцій європейців в Америку і Австралію вона становить значну частку і там. Визначається однонуклеотидних поліморфізмом M343, відкритим в 2004 році [3]. З 2001 по 2005 рік R1b визначали наявністю ОНП P25. В інших системах класифікації - Hg1 і Eu18. [4]

Походить з R1, як і R1a.


1. Походження

Поширення гаплогрупи R1b в Європі.

Британські генетики Брайан Сайкс і Стівен Оппенгеймер стверджують, що гаплогрупа R1b не має відношення до індоєвропейської заселення Західної Європи і походить від палеолітичного (доїндоєвропейськоє) населення Іберії. Погляди Сайкса і Оппенгеймера отримали широке поширення в Європі завдяки написаними їм популярним бестселерів про генетичну історії Європи. З іншого боку, подібний погляд на походження R1b стикається з нездоланними протиріччями. Подальші дослідження встановили, що різноманітність субкладов даної гаплогрупи збільшується у міру руху на схід, що скоріше говорить про східне походження даної гаплогрупи [5]. Ряд сучасних генетиків вважають, що R1b зародилася в Центральної [6] або Західній Азії [7].

Спочатку була висунута гіпотеза, що R1b є корінною для Західної Європи, оскільки саме там вона переважає. Згодом було доведено, що гаплотипи R1b демонструють більшу різноманітність малих побічних відгалужень в Анатолії та на Кавказі, ніж в Європі. Також європейські субклади більш молоді в порівнянні зі середньосхідна або центральноазіатськими. Основна західноєвропейська гілку R-P312/S116 сходить лише до 3500 або 3000 до н. е.., отже, найстаріший загальний предок цієї лінії жив принаймні 5000 - 5500 років тому в долині нижнього Дунаю або в Причорномор'ї. По-любому, ці тимчасові рамки занадто малі для палеолітичного походження або неолітичного пришестя R1b. Відкриття субкладов гаплогрупи R1b в Середній Азії, Пакистані та Індії остаточно спростувало її палеолітичне походження в Західній Європі і підтвердило її зв'язок з індоєвропейцями [8].

Цей висновок підтверджується подальшими дослідженнями підгрупи R1b1a2, носієм якої був фараон Тутанхамон. Вона зародилася на Кавказі близько 9500 років тому і почала міграцію до Європи близько 7000 років тому. Частина її представників мігрувала в Північну Африку [9].


2. Проблема домінування R1b в Західній Європі

Щільність поширення гаплогрупи R1b приблизно збігається з районами будівництва мегалітів в Західній Європі. Це збіг служить одним з основананій гіпотези Сайкса і Оппенгеймера про порівняно автохтонної палеоевропейских походження даної гаплогрупи. Відповідно до даної гіпотези, носії гаплогрупи R1b є нащадками Солютрейской культури, що пережили останній льодовиковий максимум (бл. 20 тис. років тому) на Піренейському півострові в ізоляції від інших народів і ок. 10 тис. років (після танення льодовика) заселили Західну Європу [10].

Ряд більше нових досліджень [8] також піддають критиці гіпотезу Сайкса. Зокрема, передбачається, що R1b слід асоціювати з індоєвропейцями (зокрема в більш пізній час у Західній Європі - особливо з кельтами) [11], які прийшли з Причорномор'я приблизно 5000 років тому (передбачається, що спочатку також носії праіндоєвропейської культури з гаплогрупою R1a займали переважно північну частину ареалу, тоді як R1b - більш південну, можливо, що включає Кавказ і Анатолію).

При цьому виникає деяка складність пояснення того, чому більшість сучасних чоловіків Західної Європи виявляються нащадками вихідців з Понтійського регіону. Однак наводяться демографічні викладки, що показують, що в разі встановлення гегемонії з боку прибульців, технологічно превосходивших автохтонне населення, чоловічі лінії переможців можуть повністю витіснити чоловічу лінію спадковості місцевого населення за кілька століть. Значна частина чоловіків могла бути вбита відразу у військових зіткненнях, надалі ж сім'ї місцевих чоловіків отримували більш низький статус і могли відтворювати менше дітей. З часу встановлення в Західній Європі панування кельтів до більш лояльних часів Римської імперії пройшло приблизно вісім століть, за які автохтонні гаплогрупи цілком могли повністю зникнути. У Центральній і Східній Європі до часу вторгнення індоєвропейців існувала більш розвинена землеробська культура, тому в цих районах витіснення старих гаплогрупп не було таким повним.


3. Підгрупи (субклади)

M343
P25

R-M18 (R1b1a)


P297

R-M73 (R1b1b1)


M269
P311
P310
U106

R-U198 (R1b1b2a1a1)



R-S26 (R1b1b2a1a2)



R-L44 (R1b1b2a1a4)



R-U106 * (R1b1b2a1a *)



P312

R-M153 (R1b1b2a1b2)



R-M167 (R1b1b2a1b3)


U152
L2

R-L20 (R1b1b2a1b4c1)



R-L2 * (R1b1b2a1b4c *)




R-U152 * (R1b1b2a1b4 *)




R-S68 (R1b1b2a1b5)


L21

R-M222 (R1b1b2a1b6b)



R-L21 * (R1b1b2a1b6 *)




R-P312 * (R1b1b2a1b *)




R-P310 * (R1b1b2a1 *)




R-P311 * (R1b1b2a *)




R-M269 * (R1b1b2 *)




R-P297 * (R1b1b *)




R-P25 * (R1b1 *)




R-M343 * (R1b *)




4. Етногеографічного розподіл

R1b показана червоним
R1a показана пурпурним

4.1. Европа

Сучасна концентрація R1b максимальна на територіях, пов'язаних з кельтами: в південній Англії близько 70%, в північній і західній Англії, Уельсі, Шотландії, Ірландії - до 90% і більше, в Іспанії - 70%, у Франції - 60% [9]. Мабуть вона пов'язана з докельтские субстратом, оскільки висока її концентрація і у не-кельтів басків - 88,1% [12] і іспанців - 70% [13]. Крім того, відомо, що, наприклад, будівельниками Стоунхенджа в Англії було населення, що мешкало на острові до приходу кельтів.

У сусідніх народів концентрація даної гаплогрупи падає: у італійців - 40% [14], німців - 39% [15], норвежців - 25,9% [16] та інших.

У народів Східної Європи вона зустрічається ще рідше. У осетин Алагир - 43%, чехів і словаків - 35,6% [12], поляків - 11,6% [17] -16,4% [12], латишів - 15% [18], угорців - 13,3% [18], естонців - 9% [18], литовців - 5% [18], білорусів - 4,2% [19], російських - від 2,8% [20] до 21,3% [21], українців - від 2% [12] до 18,9% [22].

На Балканах - у греків - від 13,5% [23] до 22,8% [12], словенців - 21% [18], албанців - 17,6% [12], болгар - 17% [24], хорватів - 15,7% [25], румунів - 13% [22], сербів - 10,6% [25], герцеговинцям - 3,6% [25], боснійців - 1,4% [25].


4.2. Азія

За межами Західної Європи висока концентрація даної гаплогрупи зустрічається лише у башкир - до 87% [26], що очевидно пов'язано з присутністю кроманьонского дотюркское субстрату.

На Кавказі знайдена у осетин - 43% [18] і вірмен - 32,4% [27].

В Туреччині досягає 16% [28], Іраку - 11,3% [29] і в інших країнах Західної Азії. У Туреччині у турків - 31% [30].

У Центральній Азії виявлено, зокрема, у туркменів - 37% [31], узбеків - 9,8% [31], татар - 8,7% [21], казахів - 5,6% [31], уйгурів - від 8,2% [32] до 19,4% [33]

В Пакистані - 6,8% [34], в Індії незначна - 0,55% [35].


4.3. Північна Африка

У алжирських арабів з Орана - 10,8% [36], туніських арабів - 7% [37], алжирських берберів - 5,8% [38], в Марокко - близько 2,5% [39], у арабів Єгипту - менше 1% [9].

5. Мутації

Деталі M343 (rs9786184):

Зміна нуклеотидів: від C до A
Позиція: 402
Загальний розмір: 424
Вперед 5 '? 3 ': tttaacctcctccagctctgca
Назад 5 '? 3 ': acccccacatatctccagg

Примітки

  1. Tatiana M. Karafet, Fernando L. Mendez, Monica B. Meilerman, Peter A. Underhill, Stephen L. Zegura, and Michael F. Hammer (2008). New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree
  2. Загадки "західноєвропейської" гаплогрупи R1b. Вклад ДНК-генеалогії в лінгвістику і археологію -
  3. Cinnioglu, Cengiz; et al (January 2004). "Excavating Y-chromosome haplotype strata in Anatolia". Human Genetics 114 (2): 127-148. DOI : 10.1007/s00439-003-1031-4 - dx.doi.org/10.1007/s00439-003-1031-4. Перевірено 2007-12-13.
  4. Y Chromosome Consortium YCC NRY Tree 2002 - ycc.biosci.arizona.edu/nomenclature_system/fig1.html (en :2002-01-18).
  5. B. Arredi, ES Poloni and C. Tyler-Smith The peopling of Europe / / Anthropological genetics: theory, methods and applications / Crawford, Michael H. - Cambridge, UK: Cambridge University Press, 2007. - P. 394. - ISBN 0-521-54697-4.
  6. Variations of R1b Ydna in Europe: Distribution and Origins - www.worldfamilies.net/Tools/r1b_ydna_in_europe.
  7. International Society of Genetic Genealogy (ISOGG) - Y-DNA Haplogroup R and its Subclades - 2009 - www.isogg.org/tree/ISOGG_HapgrpR09.html
  8. 1 2 Origins, age, spread and ethnic association of European haplogroups and subclades - www.eupedia.com / europe / origins_haplogroups_europe.shtml (Англ.) . Eupedia, your guide to Europe in English (останнє оновлення: березень 2010).
  9. 1 2 3 Lenta.ru: Прогрес: Половина європейців виявилася нащадками єгипетських фараонів - lenta.ru/news/2011/08/02/pharaos /
  10. Ностратікі, Y-хромосоми і неолітична революція - www.hrono.ru/libris/lib_r/rass17indo.html
  11. Гаплогрупи російських - www.demushkin.com/content/articles/291/2497.html
  12. 1 2 3 4 5 6 Ornella Semino, A. Silvana Santachiara-Benerecetti, Francesco Falaschi, L. Luca Cavalli-Sforza and Peter A. Underhill, "Ethiopians and Khoisan Share the Deepest Clades of the Human Y-Chromosome Phylogeny," The American Journal of Human Genetics, Volume 70, Issue 1, 265-268, 1 January 2002.
  13. 582/1002, The genetic legacy of religious diversity and intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian Peninsula - www.ncbi.nlm.nih.gov/pubmed/19061982, Adams et al. 2008
  14. 280/699, Y chromosome genetic variation in the Italian peninsula is clinal and supports an admixture model for the Mesolithic-Neolithic encounter - www.ncbi.nlm.nih.gov/pubmed/17275346, Capelli et al. 2007
  15. 473/1215, Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis - www.ncbi.nlm.nih.gov/pubmed/15959808, Kayser et al. 2005
  16. [1] - www.ajhg.org/AJHG/abstract/S0002-9297 (07) 63256-X Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland - Agnar Helgason et al., 2000, Am. J. Hum. Genet. 67:697-717, 2000
  17. 106/913, Significant genetic differentiation between Poland and Germany follows present-day political borders, as revealed by Y-chromosome analysis - www.ncbi.nlm.nih.gov/pubmed/15959808, Kayser et al. 2005
  18. 1 2 3 4 5 6 Oxford Journals - mbe.oxfordjournals.org/cgi/content/full/22/10/1964/TBL1
  19. Doron M. Behar, Mark G. Thomas, Karl Skorecki, Michael F. Hammer, Ekaterina Bulygina, Dror Rosengarten, Abigail L. Jones, Karen Held, Vivian Moses, David Goldstein, Neil Bradman, and Michael E. Weale, "Multiple Origins of Ashkenazi Levites: Y Chromosome Evidence for Both Near Eastern and European Ancestries," American Journal of Human Genetics 73:768-779, 2003.
  20. Balanovsky
  21. 1 2 Tambets et al., " The Western and Eastern Roots of the Saami-the Story of Genetic 'Outliers' Told by Mitochondrial DNA and Y Chromosomes - www.ncbi.nlm.nih.gov/pmc/articles/PMC1181943/ " , American Journal of Human Genetics Т. 74: 661-682, doi : 10.1086/383203 - dx.doi.org/10.1086/383203 , < http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1181943/ - www.ncbi.nlm.nih.gov/pmc/articles/PMC1181943/>
  22. 1 2 Alexander Varzari, "Population History of the Dniester-Carpathians: Evidence from Alu Insertion and Y-Chromosome Polymorphisms" (2006)
  23. RJ King, SS zcan, T. Carter, E. Kalfoğlu, S. Atasoy, C. Triantaphyllidis, A. Kouvatsi, AA Lin, CE. T. Chow, LA Zhivotovsky, M. Michalodimitrakis, PA Underhill (2008), "Differential Y-chromosome Anatolian Influences on the Greek and Cretan Neolithic," Annals of Human Genetics 72 (2), 205-214 doi: 10.1111/j.1469-1809.2007.00414.x - www .blackwell-synergy.com/doi/abs/10.1111/j.1469-1809.2007.00414.x? journalCode = ahg
  24. Rosser et al. (2000)
  25. 1 2 3 4 Pericic, M; Lauc LB, Klaric IM, Rootsi S, Janicijevic B, Rudan I, Terzic R, Colak I, Kvesic A, Popovic D, Sijacki A, Behluli I, Dordevic D, Efremovska L, Bajec DD, Stefanovic BD, Villems R, Rudan P (2005). " High-resolution phylogenetic analysis of southeastern Europe traces major episodes of paternal gene flow among Slavic populations - mbe.oxfordjournals.org/cgi/content/full/22/10/1964 ". Mol. Biol. Evol. 22 (10): 1964-75. DOI : 10.1093/molbev/msi185 - dx.doi.org/10.1093/molbev/msi185. PMID 15944443. Haplogroup Frequency Data In Table 1 - mbe.oxfordjournals.org/cgi/content/full/22/10/1964/TBL1
  26. AS Lobov et al. (2009), "Y chromosome analysis in subpopulations of Bashkirs from Russia" (original text in - ftp.anrb.ru / molgen / Lobov_AS.PDF Russian)
  27. 238/734, Weale et al. (2004)
  28. 76/523, Y-Chromosome Excavating Y-chromosome haplotype strata in Anatolia - www.ncbi.nlm.nih.gov/pubmed/14586639, Cinnioglu et al. 2004
  29. 16/139, Zaheri et al. 2003, Y-chromosome and mtDNA polymorphisms in Iraq - www.ncbi.nlm.nih.gov/pubmed/12927131
  30. Nasidze et al. (2004)
  31. 1 2 3 R. Spencer Wells et al., "The Eurasian Heartland: A continental perspective on Y-chromosome diversity," Proceedings of the National Academy of Sciences of the United States of America (en: August 28, en: 2001)
  32. Ruixia Zhou, Daqun Yang, Hua Zhang, Weiping Yu, Lizhe An, Xilong Wang, Hong Li, Jiujin Xu, and Xiaodong Xie, "Origin and evolution of two Yugur sub-clans in Northwest China: a case study in paternal genetic landscape, "Annals of Human Biology (2008), 35:2, 198-211.
  33. Yali Xue, Tatiana Zerjal, Weidong Bao, Suling Zhu, Qunfang Shu, Jiujin Xu, Ruofu Du, Songbin ***, Pu Li, Matthew E. Hurles, Huanming Yang, Chris Tyler-Smith, "Male demography in East Asia: a north-south contrast in human population expansion times," Genetics 2006.
  34. Qamar et al. (2002), Cruciani et al. (2004), Semino et al. (2004), Underhill et al. (2000)
  35. 13/176 in Pakistan and 4/728 in India, Polarity and Temporality of High-Resolution Y-Chromosome Distributions in India Identify Both Indigenous and Exogenous Expansions and Reveal Minor Genetic Influence of Central Asian Pastoralists - www.ncbi.nlm.nih.gov / pubmed/16400607, Sengupta et al. 2008
  36. 11/102, Analysis of Y-chromosomal SNP haplogroups and STR haplotypes in an Algerian population sample - www.ncbi.nlm.nih.gov/sites/entrez?db=pubmed&uid=17909833&cmd=showdetailview&indexed=google
  37. 10/139 Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula - www.ncbi.nlm.nih.gov/pubmed/19061982?dopt=AbstractThe, Adams et al. 2008
  38. 3/54 Arredi et al. 2004
  39. Combined Adams et al. 2008; Bosch et al. 2001 and Maria Brotilini et al. 2004

Цей текст може містити помилки.

Схожі роботи | скачати

Схожі роботи:
Гаплогруппа R1 (Y-ДНК)
Гаплогруппа CT (Y-ДНК)
Гаплогруппа R (Y-ДНК)
Гаплогруппа J (Y-ДНК)
Гаплогруппа L (Y-ДНК)
Гаплогруппа T (Y-ДНК)
Гаплогруппа G (Y-ДНК)
Гаплогруппа I (Y-ДНК)
Гаплогруппа J2 (Y-ДНК)
© Усі права захищені
написати до нас